Playing with some modeling software...



-Loki

So to clear this up for me you are hoping to take the high from a weed plant and insert it into a African Violet? How would one even start on a project like this. Not to be discouraging I imagine such things could be possible but with out a university or government backing it with grants it looks tough. Do you have the equipment to begin on this endeavor? Good luck it would certainly be a breakthrough in growing.

The high from Cannabis, and flavors from lemons, oranges and grapes.


I started by finding the amino acid sequences of the Cannaboids and terpenes I want to use. From there, you can work that back to its mRNA and then DNA sequences.

Once you have the genes isolated. You have to hook them together. And then put a gene promoter at the beginning and a stop codon at the end.

Then you put that DNA in a E Coli plasmid, mix it with African Violet plasmids, fuse the two together... and then grow into cells and then plants...


Yes, I do.


Thanks...

-Loki

I'm sure everyone is wondering just how the hell you go about isolating and splicing genes together...

Well, its all thanks to PCR, Polymerase Chain Reaction.

Polymerase is a special protein that copys DNA chains.
It works by finding a start spot on a DNA chain and building along it until it hits a stop spot, those spots are called Primers.

A Polymerase reaction is when you take DNA mixed with Primers and heat them. The DNA separates into 2 strands. Then when you cool it, because there are more Primers than DNA strands, most DNA strands bind with Primers. Then the Polymerase duplicates the DNA strands, but just between the Primers. Hence Polymerase Chain Reaction, is simply heating and cooling DNA mixed with Primers and Polymerase.

Here's an example...

Say your original DNA sequence is ATTGCTCTAATGTTCACGGGTTCATAAGGCCCAAAA

And you know your gene sequence is ATGTTCACGGGTTCATAA (see it in the genome above? color coded, sweet, eh?)

So, you use ATGT for your forward Primer and ATAA for your reverse Primer (actually its slightly different, I'm going to do this with one strand, so I don't have to put it in a code window to keep the spacing, but the primers aren't 'in' the strand, they compliment it and attach to it).

So, after the first heat cycle we have a strand of DNA (actually 2) with primers attached to it.
ATTGCTCTAATGTTCACGGGTTCATAAGGCCCAAAA

Now the Polymerase makes a copy of the DNA between the primers.
And now we have 2 strands of DNA (actually 4) that look like
ATGTTCACGGGTTCATAA
ATTGCTCTAATGTTCACGGGTTCATAAGGCCCAAAA

Cycle again and we have..
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATTGCTCTAATGTTCACGGGTTCATAAGGCCCAAAA

Cycle again and we have..
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATGTTCACGGGTTCATAA
ATTGCTCTAATGTTCACGGGTTCATAAGGCCCAAAA

And so on... After 30 or so cycles, you have a couple million copies of your gene.

In part two, I'll talk about using PCR to connect DNA...

-Loki

Very interesting Loki, man you should be teaching at university with the knowledge you have. Could your technique be used to manipulate most of the characteristic traits of cannabis (IE color of flowers or even life cycle)? Have you had any success changing any such traits previously?

And a suggestion but I think your should try to introduce THC to lawn grass. That would be fun.

Sure, with the right information, you can do just about anything.
Having the right information is key though. I can do this because the genes I'm after create known compounds.
I can use those compounds to find the genes that make them.


No, this is my first go a DNA transformation...


Its on my list...

-Loki

So, now that we know how to isolate a gene, how do we hook two genes together?

Well, PCR can help us here too. It let's us put handles on our genes. With these handles,
we can use enzymes to join DNA strands together.

It works just like isolating DNA, but this time we start with an isolated gene and make it bigger,
versus taking a long strand of DNA (a genome) and taking just a piece of it (a gene)...

Let's take the gene from part one, ATGTTCACGGGTTCATAA, and add a handle, GATAC to the end of it.

To do this, we just modify the reverse primer.
It was ATAA, but now we'll make it ATAAGATAC. Our forward primer still is ATGT.

One thing I didn't mention about the PCR mix is that in addition to the DNA, Primers and Polymerase, are nuecleotides.
Nuecleotides are the things that make up the A, C, G and T's in the DNA strand.
And in the PCR mix, they are used by the Polymerase as it copies the DNA strand.

When we do the PCR, after the first cycle we have..
ATGTTCACGGGTTCATAAGATAC
ATGTTCACGGGTTCATAA

next cycle...
ATGTTCACGGGTTCATAAGATAC
ATGTTCACGGGTTCATAAGATAC
ATGTTCACGGGTTCATAAGATAC
ATGTTCACGGGTTCATAA

And so on, until we've got millions of our gene with a handle on it.
Now to join two strands, you use enzymes to cut the handles apart and make whats called 'sticky' ends.
Then another enzyme hooks those ends together.

You need to look at both strands of the DNA when you do this...
Usually, you just talk about one strand, because the other is understood to be its compliment.
This is our gene with both strands, with the handle in blue.

ATGTTCACGGGTTCATAAGATAC
TACAAGTGCCCAAGTATTCTATG

Now, let's take a new gene, ATGGTCTCAGTGTACTAA,
and add the same handle to the begining GATACATGGTCTCAGTGTACTAA.
So, both strands of our new gene with a handle is...

GATACATGGTCTCAGTGTACTAA
CTATGTACCAGAGTCACATGATT

Now, we'll use an enzyme, called a restriction enzyme because it cuts DNA, to cut the handles like this..

GATAC
CTATG

So, we have two strands now where the grey colored bit drops out.

ATGTTCACGGGTTCATAAGATAC GATACATGGTCTCAGTGTACTAA
TACAAGTGCCCAAGTATTCTATG CTATGTACCAGAGTCACATGATT

And then they join together...
ATGTTCACGGGTTCATAAGATACATGGTCTCAGTGTACTAA
TACAAGTGCCCAAGTATTCTATGTACCAGAGTCACATGATT

That does create a 'scar' between the genes, but there is a method to remove that...
I'll make that part three, if anyone is interested.

-Loki

even tho this is WAY over my head, i enjoy reading them. especially this subject, such an excellent experiment!

Does that stuff make sense?
Its looks kind of complicated, but its really pretty straight forward.

PCR is the backbone of DNA sequencing too.
They made special Nuecleotides (the A, C, G and T's) that glow under a laser
and stop the Polymerase reaction after they get put in the DNA strand.

So, Say you have a gene ATGTTCACGGGTTCATAA.
And you PCR it with the regular nuecleotides, and a special C nuecleotide.
You'd get strands that look like

ATGTTC
ATGTTCAC
ATGTTCACGGGTTC

Add in Special A T and G... all in a different color.
And you get...
A
AT
ATG
ATGT
ATGTT
ATGTTC
ATGTTCA
ATGTTCAC
ATGTTCACG
etc...

You line them up and scan them with a laser and you have the sequence.

The first complete genome sequenced in 1985 had ~80 base pairs, and it took 5 years to sequence.
Now, it can be done in under a minute.

-Loki

lol im sorry for interupting and correct me if im wrong but would this not be called nanotechnology? since your using nucleotides and such ... . jus a question..and btw this is awesome and you should definately keep at it!